Recombinant:
Article Title: Mycorrhizal Fungi Respond to Resource Inequality by Moving Phosphorus from Rich to Poor Patches across Networks
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Carboxyl terminated quantum-dots 488 nm Crystalplex N/A Carboxyl terminated quantum-dots 666 nm Crystalplex N/A PhytagelTM SIGMA-ALDRICH Cat#P8169 Critical Commercial Assays DNeasy Plant Maxi Kit QIAGEN Cat#68163 iTaq Universal Probes Supermix BIO-RAD Cat#1725134 Deposited Data Dryad data repository Dryad data repository Dryad doi: https://doi.org/ 10.5061/dryad.n343sh3 Experimental Models: Organisms/Strains Ri T-DNA Daucus carota transformed root cultures Prof. Jan Jansa Institute of Microbiology Czech Academy of Sciences Prague, Czech Republic N/A Rhizophagus irregularis strain A5 Prof. dr. Ian Sanders, Department of Ecology and Evolution, Universit e de Lausanne, Switzerland N/A Medicago truncatula Gaertn Prof. B. Hause, Leibniz Institute of Plant Biochemistry, Halle, Germany N/A Oligonucleotides Forward primer internal standard: CGAACCTGGACTGTTATGATG [17] N/A Reverse primer internal standard: AATAAACAATCCCCTGTATTTCAC [17] N/A TaqMan probe internal standard: CACCAGGCACCAACAACGACCATT [17] N/A Forward primer R. irregularis: TTTTAGCGATAGCGTAACAGC [17] N/A Reverse primer R. irregularis: TACATCTAGGACAGGGTTTCG [17] N/A TaqMan probe R. irregularis AAACTGCCACTCCCTCCATATCCAA [17] N/A Software and Algorithms SimFCS version 4 software Laboratory for Fluorescence Dynamics, University of California, Irvine, USA N/A Fiji [41] N/A R 3.4.4 R core N/A MATLAB R2016a Mathworks N/A Bio-Rad CFX Manager Software Bio-Rad N/A TrackMate [27] N/A Other Petri dishes- 90mm, 3 compartments, vents VWR Cat#710-3518 Petri dishes- 90mm, 2 compartments, vents VWR Cat#710-3509 Whatman Membrane filter, cellulose-nitrate, 45 mm, 47 mm SIGMA-ALDRICH Cat#10401112 Cell imaging plates, 96-well glass bottomed Eppendorf Cat#30741030 Thermo Savant FastPrep Fp120 Cell homogenizer Thermo N/A Olympus Confocal Laser scanning microscope, FluoView FV1000 Olympus N/A Olympus UPLSAPO 60 WX objective, water immersed Olympus N/A Quadro dichroic mirror: 405/488/560/635 N/A N/A Emission filter: 455-500 nm N/A N/A Emission filter: 610-710 nm N/A N/A Pulsed laser, 20MHz, 405 nm PicoQuant N/A BioTek Synergy MX plate reader BioTek N/A (Continued on next page) Current Biology 29, 2043–2050.e1–e8, June 17, 2019 e1
Transformation Assay:
Article Title: Mycorrhizal Fungi Respond to Resource Inequality by Moving Phosphorus from Rich to Poor Patches across Networks
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Carboxyl terminated quantum-dots 488 nm Crystalplex N/A Carboxyl terminated quantum-dots 666 nm Crystalplex N/A PhytagelTM SIGMA-ALDRICH Cat#P8169 Critical Commercial Assays DNeasy Plant Maxi Kit QIAGEN Cat#68163 iTaq Universal Probes Supermix BIO-RAD Cat#1725134 Deposited Data Dryad data repository Dryad data repository Dryad doi: https://doi.org/ 10.5061/dryad.n343sh3 Experimental Models: Organisms/Strains Ri T-DNA Daucus carota transformed root cultures Prof. Jan Jansa Institute of Microbiology Czech Academy of Sciences Prague, Czech Republic N/A Rhizophagus irregularis strain A5 Prof. dr. Ian Sanders, Department of Ecology and Evolution, Universit e de Lausanne, Switzerland N/A Medicago truncatula Gaertn Prof. B. Hause, Leibniz Institute of Plant Biochemistry, Halle, Germany N/A Oligonucleotides Forward primer internal standard: CGAACCTGGACTGTTATGATG [17] N/A Reverse primer internal standard: AATAAACAATCCCCTGTATTTCAC [17] N/A TaqMan probe internal standard: CACCAGGCACCAACAACGACCATT [17] N/A Forward primer R. irregularis: TTTTAGCGATAGCGTAACAGC [17] N/A Reverse primer R. irregularis: TACATCTAGGACAGGGTTTCG [17] N/A TaqMan probe R. irregularis AAACTGCCACTCCCTCCATATCCAA [17] N/A Software and Algorithms SimFCS version 4 software Laboratory for Fluorescence Dynamics, University of California, Irvine, USA N/A Fiji [41] N/A R 3.4.4 R core N/A MATLAB R2016a Mathworks N/A Bio-Rad CFX Manager Software Bio-Rad N/A TrackMate [27] N/A Other Petri dishes- 90mm, 3 compartments, vents VWR Cat#710-3518 Petri dishes- 90mm, 2 compartments, vents VWR Cat#710-3509 Whatman Membrane filter, cellulose-nitrate, 45 mm, 47 mm SIGMA-ALDRICH Cat#10401112 Cell imaging plates, 96-well glass bottomed Eppendorf Cat#30741030 Thermo Savant FastPrep Fp120 Cell homogenizer Thermo N/A Olympus Confocal Laser scanning microscope, FluoView FV1000 Olympus N/A Olympus UPLSAPO 60 WX objective, water immersed Olympus N/A Quadro dichroic mirror: 405/488/560/635 N/A N/A Emission filter: 455-500 nm N/A N/A Emission filter: 610-710 nm N/A N/A Pulsed laser, 20MHz, 405 nm PicoQuant N/A BioTek Synergy MX plate reader BioTek N/A (Continued on next page) Current Biology 29, 2043–2050.e1–e8, June 17, 2019 e1
Software:
Article Title: Mycorrhizal Fungi Respond to Resource Inequality by Moving Phosphorus from Rich to Poor Patches across Networks
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Carboxyl terminated quantum-dots 488 nm Crystalplex N/A Carboxyl terminated quantum-dots 666 nm Crystalplex N/A PhytagelTM SIGMA-ALDRICH Cat#P8169 Critical Commercial Assays DNeasy Plant Maxi Kit QIAGEN Cat#68163 iTaq Universal Probes Supermix BIO-RAD Cat#1725134 Deposited Data Dryad data repository Dryad data repository Dryad doi: https://doi.org/ 10.5061/dryad.n343sh3 Experimental Models: Organisms/Strains Ri T-DNA Daucus carota transformed root cultures Prof. Jan Jansa Institute of Microbiology Czech Academy of Sciences Prague, Czech Republic N/A Rhizophagus irregularis strain A5 Prof. dr. Ian Sanders, Department of Ecology and Evolution, Universit e de Lausanne, Switzerland N/A Medicago truncatula Gaertn Prof. B. Hause, Leibniz Institute of Plant Biochemistry, Halle, Germany N/A Oligonucleotides Forward primer internal standard: CGAACCTGGACTGTTATGATG [17] N/A Reverse primer internal standard: AATAAACAATCCCCTGTATTTCAC [17] N/A TaqMan probe internal standard: CACCAGGCACCAACAACGACCATT [17] N/A Forward primer R. irregularis: TTTTAGCGATAGCGTAACAGC [17] N/A Reverse primer R. irregularis: TACATCTAGGACAGGGTTTCG [17] N/A TaqMan probe R. irregularis AAACTGCCACTCCCTCCATATCCAA [17] N/A Software and Algorithms SimFCS version 4 software Laboratory for Fluorescence Dynamics, University of California, Irvine, USA N/A Fiji [41] N/A R 3.4.4 R core N/A MATLAB R2016a Mathworks N/A Bio-Rad CFX Manager Software Bio-Rad N/A TrackMate [27] N/A Other Petri dishes- 90mm, 3 compartments, vents VWR Cat#710-3518 Petri dishes- 90mm, 2 compartments, vents VWR Cat#710-3509 Whatman Membrane filter, cellulose-nitrate, 45 mm, 47 mm SIGMA-ALDRICH Cat#10401112 Cell imaging plates, 96-well glass bottomed Eppendorf Cat#30741030 Thermo Savant FastPrep Fp120 Cell homogenizer Thermo N/A Olympus Confocal Laser scanning microscope, FluoView FV1000 Olympus N/A Olympus UPLSAPO 60 WX objective, water immersed Olympus N/A Quadro dichroic mirror: 405/488/560/635 N/A N/A Emission filter: 455-500 nm N/A N/A Emission filter: 610-710 nm N/A N/A Pulsed laser, 20MHz, 405 nm PicoQuant N/A BioTek Synergy MX plate reader BioTek N/A (Continued on next page) Current Biology 29, 2043–2050.e1–e8, June 17, 2019 e1
Fluorescence:
Article Title: Mycorrhizal Fungi Respond to Resource Inequality by Moving Phosphorus from Rich to Poor Patches across Networks
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Carboxyl terminated quantum-dots 488 nm Crystalplex N/A Carboxyl terminated quantum-dots 666 nm Crystalplex N/A PhytagelTM SIGMA-ALDRICH Cat#P8169 Critical Commercial Assays DNeasy Plant Maxi Kit QIAGEN Cat#68163 iTaq Universal Probes Supermix BIO-RAD Cat#1725134 Deposited Data Dryad data repository Dryad data repository Dryad doi: https://doi.org/ 10.5061/dryad.n343sh3 Experimental Models: Organisms/Strains Ri T-DNA Daucus carota transformed root cultures Prof. Jan Jansa Institute of Microbiology Czech Academy of Sciences Prague, Czech Republic N/A Rhizophagus irregularis strain A5 Prof. dr. Ian Sanders, Department of Ecology and Evolution, Universit e de Lausanne, Switzerland N/A Medicago truncatula Gaertn Prof. B. Hause, Leibniz Institute of Plant Biochemistry, Halle, Germany N/A Oligonucleotides Forward primer internal standard: CGAACCTGGACTGTTATGATG [17] N/A Reverse primer internal standard: AATAAACAATCCCCTGTATTTCAC [17] N/A TaqMan probe internal standard: CACCAGGCACCAACAACGACCATT [17] N/A Forward primer R. irregularis: TTTTAGCGATAGCGTAACAGC [17] N/A Reverse primer R. irregularis: TACATCTAGGACAGGGTTTCG [17] N/A TaqMan probe R. irregularis AAACTGCCACTCCCTCCATATCCAA [17] N/A Software and Algorithms SimFCS version 4 software Laboratory for Fluorescence Dynamics, University of California, Irvine, USA N/A Fiji [41] N/A R 3.4.4 R core N/A MATLAB R2016a Mathworks N/A Bio-Rad CFX Manager Software Bio-Rad N/A TrackMate [27] N/A Other Petri dishes- 90mm, 3 compartments, vents VWR Cat#710-3518 Petri dishes- 90mm, 2 compartments, vents VWR Cat#710-3509 Whatman Membrane filter, cellulose-nitrate, 45 mm, 47 mm SIGMA-ALDRICH Cat#10401112 Cell imaging plates, 96-well glass bottomed Eppendorf Cat#30741030 Thermo Savant FastPrep Fp120 Cell homogenizer Thermo N/A Olympus Confocal Laser scanning microscope, FluoView FV1000 Olympus N/A Olympus UPLSAPO 60 WX objective, water immersed Olympus N/A Quadro dichroic mirror: 405/488/560/635 N/A N/A Emission filter: 455-500 nm N/A N/A Emission filter: 610-710 nm N/A N/A Pulsed laser, 20MHz, 405 nm PicoQuant N/A BioTek Synergy MX plate reader BioTek N/A (Continued on next page) Current Biology 29, 2043–2050.e1–e8, June 17, 2019 e1
Membrane:
Article Title: Mycorrhizal Fungi Respond to Resource Inequality by Moving Phosphorus from Rich to Poor Patches across Networks
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Carboxyl terminated quantum-dots 488 nm Crystalplex N/A Carboxyl terminated quantum-dots 666 nm Crystalplex N/A PhytagelTM SIGMA-ALDRICH Cat#P8169 Critical Commercial Assays DNeasy Plant Maxi Kit QIAGEN Cat#68163 iTaq Universal Probes Supermix BIO-RAD Cat#1725134 Deposited Data Dryad data repository Dryad data repository Dryad doi: https://doi.org/ 10.5061/dryad.n343sh3 Experimental Models: Organisms/Strains Ri T-DNA Daucus carota transformed root cultures Prof. Jan Jansa Institute of Microbiology Czech Academy of Sciences Prague, Czech Republic N/A Rhizophagus irregularis strain A5 Prof. dr. Ian Sanders, Department of Ecology and Evolution, Universit e de Lausanne, Switzerland N/A Medicago truncatula Gaertn Prof. B. Hause, Leibniz Institute of Plant Biochemistry, Halle, Germany N/A Oligonucleotides Forward primer internal standard: CGAACCTGGACTGTTATGATG [17] N/A Reverse primer internal standard: AATAAACAATCCCCTGTATTTCAC [17] N/A TaqMan probe internal standard: CACCAGGCACCAACAACGACCATT [17] N/A Forward primer R. irregularis: TTTTAGCGATAGCGTAACAGC [17] N/A Reverse primer R. irregularis: TACATCTAGGACAGGGTTTCG [17] N/A TaqMan probe R. irregularis AAACTGCCACTCCCTCCATATCCAA [17] N/A Software and Algorithms SimFCS version 4 software Laboratory for Fluorescence Dynamics, University of California, Irvine, USA N/A Fiji [41] N/A R 3.4.4 R core N/A MATLAB R2016a Mathworks N/A Bio-Rad CFX Manager Software Bio-Rad N/A TrackMate [27] N/A Other Petri dishes- 90mm, 3 compartments, vents VWR Cat#710-3518 Petri dishes- 90mm, 2 compartments, vents VWR Cat#710-3509 Whatman Membrane filter, cellulose-nitrate, 45 mm, 47 mm SIGMA-ALDRICH Cat#10401112 Cell imaging plates, 96-well glass bottomed Eppendorf Cat#30741030 Thermo Savant FastPrep Fp120 Cell homogenizer Thermo N/A Olympus Confocal Laser scanning microscope, FluoView FV1000 Olympus N/A Olympus UPLSAPO 60 WX objective, water immersed Olympus N/A Quadro dichroic mirror: 405/488/560/635 N/A N/A Emission filter: 455-500 nm N/A N/A Emission filter: 610-710 nm N/A N/A Pulsed laser, 20MHz, 405 nm PicoQuant N/A BioTek Synergy MX plate reader BioTek N/A (Continued on next page) Current Biology 29, 2043–2050.e1–e8, June 17, 2019 e1
Imaging:
Article Title: Mycorrhizal Fungi Respond to Resource Inequality by Moving Phosphorus from Rich to Poor Patches across Networks
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Carboxyl terminated quantum-dots 488 nm Crystalplex N/A Carboxyl terminated quantum-dots 666 nm Crystalplex N/A PhytagelTM SIGMA-ALDRICH Cat#P8169 Critical Commercial Assays DNeasy Plant Maxi Kit QIAGEN Cat#68163 iTaq Universal Probes Supermix BIO-RAD Cat#1725134 Deposited Data Dryad data repository Dryad data repository Dryad doi: https://doi.org/ 10.5061/dryad.n343sh3 Experimental Models: Organisms/Strains Ri T-DNA Daucus carota transformed root cultures Prof. Jan Jansa Institute of Microbiology Czech Academy of Sciences Prague, Czech Republic N/A Rhizophagus irregularis strain A5 Prof. dr. Ian Sanders, Department of Ecology and Evolution, Universit e de Lausanne, Switzerland N/A Medicago truncatula Gaertn Prof. B. Hause, Leibniz Institute of Plant Biochemistry, Halle, Germany N/A Oligonucleotides Forward primer internal standard: CGAACCTGGACTGTTATGATG [17] N/A Reverse primer internal standard: AATAAACAATCCCCTGTATTTCAC [17] N/A TaqMan probe internal standard: CACCAGGCACCAACAACGACCATT [17] N/A Forward primer R. irregularis: TTTTAGCGATAGCGTAACAGC [17] N/A Reverse primer R. irregularis: TACATCTAGGACAGGGTTTCG [17] N/A TaqMan probe R. irregularis AAACTGCCACTCCCTCCATATCCAA [17] N/A Software and Algorithms SimFCS version 4 software Laboratory for Fluorescence Dynamics, University of California, Irvine, USA N/A Fiji [41] N/A R 3.4.4 R core N/A MATLAB R2016a Mathworks N/A Bio-Rad CFX Manager Software Bio-Rad N/A TrackMate [27] N/A Other Petri dishes- 90mm, 3 compartments, vents VWR Cat#710-3518 Petri dishes- 90mm, 2 compartments, vents VWR Cat#710-3509 Whatman Membrane filter, cellulose-nitrate, 45 mm, 47 mm SIGMA-ALDRICH Cat#10401112 Cell imaging plates, 96-well glass bottomed Eppendorf Cat#30741030 Thermo Savant FastPrep Fp120 Cell homogenizer Thermo N/A Olympus Confocal Laser scanning microscope, FluoView FV1000 Olympus N/A Olympus UPLSAPO 60 WX objective, water immersed Olympus N/A Quadro dichroic mirror: 405/488/560/635 N/A N/A Emission filter: 455-500 nm N/A N/A Emission filter: 610-710 nm N/A N/A Pulsed laser, 20MHz, 405 nm PicoQuant N/A BioTek Synergy MX plate reader BioTek N/A (Continued on next page) Current Biology 29, 2043–2050.e1–e8, June 17, 2019 e1
Laser-Scanning Microscopy:
Article Title: Mycorrhizal Fungi Respond to Resource Inequality by Moving Phosphorus from Rich to Poor Patches across Networks
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Carboxyl terminated quantum-dots 488 nm Crystalplex N/A Carboxyl terminated quantum-dots 666 nm Crystalplex N/A PhytagelTM SIGMA-ALDRICH Cat#P8169 Critical Commercial Assays DNeasy Plant Maxi Kit QIAGEN Cat#68163 iTaq Universal Probes Supermix BIO-RAD Cat#1725134 Deposited Data Dryad data repository Dryad data repository Dryad doi: https://doi.org/ 10.5061/dryad.n343sh3 Experimental Models: Organisms/Strains Ri T-DNA Daucus carota transformed root cultures Prof. Jan Jansa Institute of Microbiology Czech Academy of Sciences Prague, Czech Republic N/A Rhizophagus irregularis strain A5 Prof. dr. Ian Sanders, Department of Ecology and Evolution, Universit e de Lausanne, Switzerland N/A Medicago truncatula Gaertn Prof. B. Hause, Leibniz Institute of Plant Biochemistry, Halle, Germany N/A Oligonucleotides Forward primer internal standard: CGAACCTGGACTGTTATGATG [17] N/A Reverse primer internal standard: AATAAACAATCCCCTGTATTTCAC [17] N/A TaqMan probe internal standard: CACCAGGCACCAACAACGACCATT [17] N/A Forward primer R. irregularis: TTTTAGCGATAGCGTAACAGC [17] N/A Reverse primer R. irregularis: TACATCTAGGACAGGGTTTCG [17] N/A TaqMan probe R. irregularis AAACTGCCACTCCCTCCATATCCAA [17] N/A Software and Algorithms SimFCS version 4 software Laboratory for Fluorescence Dynamics, University of California, Irvine, USA N/A Fiji [41] N/A R 3.4.4 R core N/A MATLAB R2016a Mathworks N/A Bio-Rad CFX Manager Software Bio-Rad N/A TrackMate [27] N/A Other Petri dishes- 90mm, 3 compartments, vents VWR Cat#710-3518 Petri dishes- 90mm, 2 compartments, vents VWR Cat#710-3509 Whatman Membrane filter, cellulose-nitrate, 45 mm, 47 mm SIGMA-ALDRICH Cat#10401112 Cell imaging plates, 96-well glass bottomed Eppendorf Cat#30741030 Thermo Savant FastPrep Fp120 Cell homogenizer Thermo N/A Olympus Confocal Laser scanning microscope, FluoView FV1000 Olympus N/A Olympus UPLSAPO 60 WX objective, water immersed Olympus N/A Quadro dichroic mirror: 405/488/560/635 N/A N/A Emission filter: 455-500 nm N/A N/A Emission filter: 610-710 nm N/A N/A Pulsed laser, 20MHz, 405 nm PicoQuant N/A BioTek Synergy MX plate reader BioTek N/A (Continued on next page) Current Biology 29, 2043–2050.e1–e8, June 17, 2019 e1
|
